Add primerprospector_analyzeprimers

modules/nf-core/primerprospector/analyzeprimers/environment.yml

@@ -0,0 +1,7 @@
+---
+# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json
+channels:
+  - conda-forge
+  - bioconda
+dependencies:
+  - bioconda::primerprospector=1.0.1

modules/nf-core/primerprospector/analyzeprimers/main.nf

@@ -0,0 +1,79 @@
+process PRIMERPROSPECTOR_ANALYZEPRIMERS {
+    tag "$meta.id"
+    label 'process_single'
+
+    conda "${moduleDir}/environment.yml"
+    container "${ workflow.containerEngine in ['singularity', 'apptainer'] && !task.ext.singularity_pull_docker_container ?
+        'https://depot.galaxyproject.org/singularity/primerprospector:1.0.1--py27_0' :
+        'quay.io/biocontainers/primerprospector:1.0.1--py27_0' }"
+
+    input:
+    tuple val(meta), path(fasta), path(primers)
+
+    output:
+    tuple val(meta), path("${prefix}_hits.txt"), emit: hits
+    tuple val(meta), path("${prefix}.ps")      , emit: plots
+    tuple val("${task.process}"), val('primerprospector'), eval("analyze_primers.py --version 2>&1 | grep -Eo '[0-9]+(\\.[0-9]+)+' | tail -n 1"), topic: versions, emit: versions_primerprospector
+
+    when:
+    task.ext.when == null || task.ext.when
+
+    script:
+    def args = task.ext.args ?: ''
+    prefix = task.ext.prefix ?: "${meta.id}"
+    def fasta_arg = fasta instanceof List ? fasta.join(':') : fasta
+    def primer_arg = primers ? "-P \"${primers}\"" : ''
+    def arg_tokens = args.tokenize()
+    if (arg_tokens.any { arg -> arg == '-f' || arg.startsWith('--fasta_seqs') || arg == '-P' || arg.startsWith('--primers_filepath') || arg == '-o' || arg.startsWith('--output_dir') }) {
+        error "'-f/--fasta_seqs', '-P/--primers_filepath' and '-o/--output_dir' are reserved by this module. Use input files for fasta/primers and task.ext.prefix to control output file prefixes."
+    }
+    if (!primers && !(arg_tokens.any { arg -> arg == '-p' || arg.startsWith('--primer_name') } && arg_tokens.any { arg -> arg == '-s' || arg.startsWith('--primer_sequence') })) {
+        error "Provide a primers file in the input tuple, or specify a single primer with '-p/--primer_name' and '-s/--primer_sequence' in task.ext.args."
+    }
+    """
+    # Bug: Primer Prospector 1.0.1 passes numpy floats to range(), which requires integer arguments, while plotting.
+    # This shim avoids a Python 2 TypeError that otherwise stops .ps output generation.
+    cat <<'PY' > analyze_primers_compat.py
+    import __builtin__
+    import os
+    import sys
+    _range = __builtin__.range
+    def _int_range(*args):
+        return _range(*[int(arg) for arg in args])
+    __builtin__.range = _int_range
+    for path_dir in os.environ.get('PATH', '').split(os.pathsep):
+        script_path = os.path.join(path_dir, 'analyze_primers.py')
+        if os.path.exists(script_path):
+            sys.argv[0] = script_path
+            execfile(script_path)
+            break
+    else:
+        raise RuntimeError('Could not find analyze_primers.py on PATH')
+    PY
+
+    python analyze_primers_compat.py \\
+        $args \\
+        -f "${fasta_arg}" \\
+        ${primer_arg}
+
+    mv *_hits.txt "${prefix}_hits.txt"
+    mv *.ps "${prefix}.ps"
+    """
+
+    stub:
+    def args = task.ext.args ?: ''
+    prefix = task.ext.prefix ?: "${meta.id}"
+    def arg_tokens = args.tokenize()
+    if (arg_tokens.any { arg -> arg == '-f' || arg.startsWith('--fasta_seqs') || arg == '-P' || arg.startsWith('--primers_filepath') || arg == '-o' || arg.startsWith('--output_dir') }) {
+        error "'-f/--fasta_seqs', '-P/--primers_filepath' and '-o/--output_dir' are reserved by this module. Use input files for fasta/primers and task.ext.prefix to control output file prefixes."
+    }
+    if (!primers && !(arg_tokens.any { arg -> arg == '-p' || arg.startsWith('--primer_name') } && arg_tokens.any { arg -> arg == '-s' || arg.startsWith('--primer_sequence') })) {
+        error "Provide a primers file in the input tuple, or specify a single primer with '-p/--primer_name' and '-s/--primer_sequence' in task.ext.args."
+    }
+    """
+    echo "$args"
+
+    touch ${prefix}_hits.txt
+    touch ${prefix}.ps
+    """
+}

modules/nf-core/primerprospector/analyzeprimers/meta.yml

@@ -0,0 +1,89 @@
+name: "primerprospector_analyzeprimers"
+description: Score PCR primers for binding to target sequences
+keywords:
+  - primer design
+  - pcr
+  - fasta
+  - sequence analysis
+  - primer scoring
+tools:
+  - "primerprospector":
+      description: "Primer Prospector is a pipeline of programs to design and analyze PCR primers."
+      homepage: "https://pprospector.sourceforge.net/"
+      documentation: "https://pprospector.sourceforge.net/scripts/analyze_primers.html"
+      tool_dev_url: "https://sourceforge.net/p/pprospector/code/"
+      doi: "10.1093/bioinformatics/btr087"
+      licence:
+        - "GPL"
+      args_id: "$args"
+      identifier: ""
+input:
+  - - meta:
+        type: map
+        description: |
+          Groovy Map containing sample information. Mandatory.
+          e.g. `[ id:'sample1' ]`
+    - fasta:
+        type: file
+        description: Target FASTA file or files to score primers against. Mandatory.
+        pattern: "*.{fasta,fa,fna}"
+        ontologies:
+          - edam: "http://edamontology.org/format_1929" # FASTA
+    - primers:
+        type: file
+        description: |
+          Tab-delimited primers file containing primer names and sequences. Optional
+          when primer name and sequence are supplied with task.ext.args.
+        pattern: "*.{txt,tsv}"
+        ontologies:
+          - edam: "http://edamontology.org/format_3475" # TSV
+output:
+  hits:
+    - - meta:
+          type: map
+          description: |
+            Groovy Map containing sample information
+            e.g. `[ id:'sample1' ]`
+      - ${prefix}_hits.txt:
+          type: file
+          description: Primer hit details, mismatches, gaps, positions, and weighted scores.
+          pattern: "*_hits.txt"
+          ontologies:
+            - edam: "http://edamontology.org/format_3752" # CSV
+  plots:
+    - - meta:
+          type: map
+          description: |
+            Groovy Map containing sample information
+            e.g. `[ id:'sample1' ]`
+      - ${prefix}.ps:
+          type: file
+          description: PostScript summary plots of primer mismatch and weighted score information.
+          pattern: "*.ps"
+          ontologies:
+            - edam: "http://edamontology.org/format_2330" # Textual format
+  versions_primerprospector:
+    - - ${task.process}:
+          type: string
+          description: The name of the process
+      - primerprospector:
+          type: string
+          description: The name of the tool
+      - analyze_primers.py --version 2>&1 | grep -Eo '[0-9]+(\.[0-9]+)+' | tail -n 1:
+          type: eval
+          description: The expression to obtain the version of the tool
+topics:
+  versions:
+    - - ${task.process}:
+          type: string
+          description: The name of the process
+      - primerprospector:
+          type: string
+          description: The name of the tool
+      - analyze_primers.py --version 2>&1 | grep -Eo '[0-9]+(\.[0-9]+)+' | tail -n 1:
+          type: eval
+          description: The expression to obtain the version of the tool
+authors:
+  - "@vagkaratzas"
+maintainers:
+  - "@vagkaratzas"

modules/nf-core/primerprospector/analyzeprimers/tests/main.nf.test

@@ -0,0 +1,77 @@
+nextflow_process {
+
+    name "Test Process PRIMERPROSPECTOR_ANALYZEPRIMERS"
+    script "../main.nf"
+    process "PRIMERPROSPECTOR_ANALYZEPRIMERS"
+
+    tag "modules"
+    tag "modules_nfcore"
+    tag "primerprospector"
+    tag "primerprospector/analyzeprimers"
+
+    test("synthetic - fasta primers - hits plots") {
+
+        when {
+            process {
+                """
+                def fasta = channel.of(
+                    '>seq1',
+                    'AAACCCGGGTTTAAACCCGGGTTT',
+                    '>seq2',
+                    'GGGTTTAAACCCGGGTTTAAA'
+                ).collectFile(name: 'test.fasta', newLine: true, sort: false)
+                def primers = channel.of(
+                    'testf\\tAAACCCGGGTTT'
+                ).collectFile(name: 'primers.txt', newLine: true, sort: false)
+
+                input[0] = fasta.combine(primers).map { fasta_file, primers_file ->
+                    [[ id:'test' ], fasta_file, primers_file]
+                }
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(
+                    process.out.hits,
+                    path(process.out.plots[0][1]).exists(),
+                    process.out.findAll { key, val -> key.startsWith("versions") }
+                ).match() }
+            )
+        }
+    }
+
+    test("synthetic - fasta primers - hits plots - stub") {
+
+        options "-stub"
+
+        when {
+            process {
+                """
+                def fasta = channel.of(
+                    '>seq1',
+                    'AAACCCGGGTTTAAACCCGGGTTT',
+                    '>seq2',
+                    'GGGTTTAAACCCGGGTTTAAA'
+                ).collectFile(name: 'test.fasta', newLine: true, sort: false)
+                def primers = channel.of(
+                    'testf\\tAAACCCGGGTTT'
+                ).collectFile(name: 'primers.txt', newLine: true, sort: false)
+
+                input[0] = fasta.combine(primers).map { fasta_file, primers_file ->
+                    [[ id:'test' ], fasta_file, primers_file]
+                }
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(sanitizeOutput(process.out)).match() }
+            )
+        }
+    }
+}

modules/nf-core/primerprospector/analyzeprimers/tests/main.nf.test.snap

@@ -0,0 +1,63 @@
+{
+    "synthetic - fasta primers - hits plots - stub": {
+        "content": [
+            {
+                "hits": [
+                    [
+                        {
+                            "id": "test"
+                        },
+                        "test_hits.txt:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "plots": [
+                    [
+                        {
+                            "id": "test"
+                        },
+                        "test.ps:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "versions_primerprospector": [
+                    [
+                        "PRIMERPROSPECTOR_ANALYZEPRIMERS",
+                        "primerprospector",
+                        "1.0.1"
+                    ]
+                ]
+            }
+        ],
+        "timestamp": "2026-05-12T11:08:06.296032028",
+        "meta": {
+            "nf-test": "0.9.5",
+            "nextflow": "26.04.0"
+        }
+    },
+    "synthetic - fasta primers - hits plots": {
+        "content": [
+            [
+                [
+                    {
+                        "id": "test"
+                    },
+                    "test_hits.txt:md5,5ad64787f36ad9ecea34d8bcd912d164"
+                ]
+            ],
+            true,
+            {
+                "versions_primerprospector": [
+                    [
+                        "PRIMERPROSPECTOR_ANALYZEPRIMERS",
+                        "primerprospector",
+                        "1.0.1"
+                    ]
+                ]
+            }
+        ],
+        "timestamp": "2026-05-12T11:07:58.777832191",
+        "meta": {
+            "nf-test": "0.9.5",
+            "nextflow": "26.04.0"
+        }
+    }
+}