Skip to content

wdecoster/STRdust

Repository files navigation

STRdust

STRdust is a tandem repeat genotyper for long reads, returning the repeat length and sequence in VCF format. STRdust performs realignment of reads overlapping with a repeat locus to an artificial reference sequence from which the repeat was removed. STRdust was developed while investigating the pathogenic GOLGA8A repeat expansion, and as such was not primarily intended as a general-purpose tandem repeat genotyper. This is reflected by a benchmark of repeat genotypers, where STRdust v0.16.0 performs the best of the tested tools on the detection of pathogenic alleles, but less so in the nucleotide-level precision of repeat lengths without expansion.

Usage

Installation

Preferably, for most users, download a ready-to-use binary for your system to add directory on your $PATH from the releases.
You may have to change the file permissions to execute it with chmod +x STRdust

Alternatively, you can install the tool using cargo:

git clone https://github.com/wdecoster/STRdust.git
cd STRdust
cargo build --release

Quick start examples

STRdust -r chr7:154654404-154654432 reference.fa sample.cram > sample.vcf
STRdust --pathogenic reference.fa sample.cram | bgzip > sample.vcf.gz
STRdust -R targets.bed --haploid chrX,chrY reference.fa male_sample.cram | bgzip > repeats.vcf.gz

The 'test_data' directory contains a small example dataset to test the tool:

STRdust -r chr7:154654404-154654432 test_data/chr7.fa.gz test_data/small-test-phased.bam > small-test-phased.vcf

All arguments

    STRdust [OPTIONS] <FASTA> <BAM>

ARGS:
    <FASTA>    reference genome used for alignment
    <BAM>      bam/cram file to call STRs in (local path or URL)

SPECIFY ONE OF:
    -r, --region <REGION>              region string to genotype expansion in (format: chr:start-end, 1-based inclusive)
    -R, --region-file <REGION_FILE>    Bed file with region(s) to genotype expansion(s) in (supports .bed and .bed.gz)
        --pathogenic                   Genotype the pathogenic STRs from STRchive

OPTIONS:
    -m, --minlen <MINLEN>              minimal length of insertion/deletion operation [default: 5]
    -s, --support <SUPPORT>            minimal number of supporting reads per haplotype [default: 3]
    -t, --threads <THREADS>            Number of parallel threads to use [default: 1]
        --sample <SAMPLE>              Sample name to use in VCF header, if not provided, the bam file name is used
        --somatic                      Print information on somatic variability
        --unphased                     Reads are not phased, will use hierarchical clustering to phase expansions
        --consensus-reads              Maximum number of reads to use to build the consensus sequence [default: 20]
        --find-outliers                Identify poorly supported outlier expansions (only with --unphased)
        --haploid <HAPLOID>            comma-separated list of haploid (sex) chromosomes
        --alignment-all                Always use full alignment (disable fast reference check via CIGAR)
    -h, --help                         Print help information
    -V, --version                      Print version information

Notes

  • BED files can be provided in plain text or gzipped format (.bed or .bed.gz)
  • Lowering the number of consensus reads may lead to lesser accurate alternative allele sequences (selecting randomly from the reads), but may greatly improve speed. Note that in the case of somatic length variation, a small number of randomly selected reads may lead to a bias and not be representative of the true repeat length.
  • Genotyping known pathogenic repeats with the --pathogenic flag will return a VCF with the pathogenic STRs from STRchive, but currently only for the GRCh38 reference.
  • By default, STRdust uses a fast reference check (QUICKREF) to skip full alignment at loci that appear to be homozygous reference. It inspects the CIGAR strings of the first 25 reads spanning a locus, and if at least 5 are found and none show a length difference from the reference of more than 3 bp, the locus is called 0|0 immediately. Loci called this way are marked with a QUICKREF flag in the VCF INFO field. This substantially speeds up runs on samples with many reference-like loci. To disable this optimisation and always perform full alignment, use --alignment-all.

Output format

STRdust produces a VCF file per sample. The consensus sequence is in the ALT field, with sequences from each read in the SEQS INFO field (when running with --somatic). The FRB FORMAT field is the total repeat length, of the two alleles, in nucleotides. The RB field is the difference between the indidiual allele lengths and the reference length. The SC FORMAT field is a measure of accuracy of the consensus sequence compared to the overlap graph from the individual reads, which could be influenced by the presence of sequencing errors or somatic variation.

Example output:

(header cropped for brevity)
##INFO=<ID=END,Number=1,Type=Integer,Description="End position of the repeat interval">
##INFO=<ID=STDEV,Number=2,Type=Integer,Description="Standard deviation of the repeat length">
##INFO=<ID=SEQS,Number=1,Type=String,Description="Sequences supporting the two alleles">
##INFO=<ID=OUTLIERS,Number=1,Type=String,Description="Outlier sequences much longer than the alleles">
##INFO=<ID=CLUSTERFAILURE,Number=0,Type=Flag,Description="If unphased input failed to cluster in two haplotype">
##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
##FORMAT=<ID=RB,Number=2,Type=Integer,Description="Repeat length of the two alleles in bases relative to reference">
##FORMAT=<ID=FRB,Number=2,Type=Integer,Description="Full repeat length of the two alleles in bases">
##FORMAT=<ID=PS,Number=1,Type=Integer,Description="Phase set identifier">
##FORMAT=<ID=SUP,Number=2,Type=Integer,Description="Read support per allele">
##FORMAT=<ID=SC,Number=2,Type=Integer,Description="Consensus score per allele">
#CHROM  POS     ID      REF     ALT     QUAL    FILTER  INFO    FORMAT  HG00271.hg38
chr1    1435798 .       TGGCGCGGAGCGGCGCGGAGCG  GCTGGCGCGGAGCGGCGCGGA,GCGGGCGCGCGCAGGA  .       .       END=1435818;STDEV=1,2     GT:RB:FRB:SUP:SC        1|2:1,-4:21,16:18,6:63,41
chr1    57367044        .       AAAATAAAATAAAATAAAATAAAATAAAATAAAATAAAATAAAATAAAATAAAATAAAATAAAATAAAATAAAATAAATAAAT     AAAATAAAATAAAATAAAATAAAATAAAATAAAATAAAATAAAATAAAATAAAATAAAATAAAATAAATAAA,AAAATAAAATAAAATAAAATAAAATAAAATAAAATAAAATAAATAAA        .       .       END=57367125;STDEV=3,0 GT:RB:FRB:SUP:SC 1|2:-9,-34:72,47:17,12:216,141

Development

Getting Started for Contributors

Prerequisites

  • Rust toolchain (install via rustup)
  • Git

First-Time Setup

  1. Clone the repository:
git clone https://github.com/wdecoster/STRdust.git
cd STRdust
  1. Install development tools and git hooks:
make setup        # Installs rustfmt, clippy, cargo-audit, cargo-outdated
make install-hooks # Installs pre-commit and pre-push hooks

The git hooks will automatically run quality checks before commits and pushes, catching issues early.

Development Workflow

Quick checks before committing:

make pre-commit   # Runs fmt, clippy, and tests

Full CI simulation before pushing:

make ci           # Runs fmt-check, clippy, and tests (same as CI)

Other useful commands:

make fmt          # Format code
make fmt-check    # Check formatting without modifying files
make clippy       # Run linter
make test         # Run tests
make build        # Build release binary
make build-musl   # Build static MUSL binary
make docs         # Generate and open documentation
make help         # Show all available targets

Testing

STRdust includes comprehensive tests, including specific tests for the --pathogenic functionality. Run tests with:

cargo test
# or
make test

For network-dependent tests (testing STRchive download functionality):

TEST_PATHOGENIC_NETWORK=1 cargo test

Code Quality Standards

Formatting

Code must be formatted with rustfmt using the project's configuration (.rustfmt.toml):

  • Max line width: 100 characters
  • Edition: 2021
  • Field init shorthand enabled

The pre-commit hook automatically runs formatting checks.

Linting

The project uses cargo clippy for linting with warnings treated as errors. Some clippy warnings are configured to be allowed in Cargo.toml:

  • too_many_arguments: Allowed because bioinformatics functions often require many parameters for configuration

Run clippy with:

cargo clippy --all-targets --all-features -- -D warnings
# or
make clippy

Security

Security audits run automatically:

make audit        # Run cargo-audit for vulnerability scanning
make outdated     # Check for outdated dependencies

Dependency Management

This project uses Dependabot to automatically keep dependencies up to date. Dependabot is configured to:

  • Check for Cargo dependency updates weekly on Mondays
  • Check for GitHub Actions updates weekly
  • Automatically create pull requests for dependency updates
  • Group minor and patch updates together for easier review
  • Auto-merge patch updates after tests pass
  • Require manual review for major version updates

The Dependabot configuration can be found in .github/dependabot.yml.

Continuous Integration

The project uses GitHub Actions for CI/CD:

  • Test workflow: Runs on all pushes and pull requests

    • Checks formatting (cargo fmt --check)
    • Runs clippy with -D warnings
    • Runs full test suite
    • Separate job for MUSL static binary build and test
    • Uses cargo caching for faster builds
  • Security workflow: Runs weekly and on every push/PR

    • Security audit with cargo-audit
    • Outdated dependency checks
    • License and security policy enforcement with cargo-deny
  • Dependabot workflow: Automatically tests and merges safe dependency updates

  • Publish workflow: Creates releases for Linux and macOS when tags are pushed

All CI checks can be simulated locally with make ci before pushing.

CITATION

If you use this tool, please consider citing our publication.