Skip to content

thomas-tams/group_13_package

Repository files navigation

dogmaVis

library(dogmaVis)

Description of content

DogmaVis is a small package which aims to reproduce the central dogma by allowing transcription of DNA to RNA and translation from RNA to amino acids.

Along with the information flow capabilities, the package also comes with a function for generating random DNA strings and a function for plotting the distribution of amino acids.

The GitHub repository for this package can be found at: https://github.com/thomas-tams-dtu/group_13_package

Functions

DogmaVis consists of 5 funtions.

  • generate_dna

  • T_to_U

  • format_to_codons

  • translate_codons

  • plot_aa_dist

Example using all functions

We run through small example which utilizes the functions of the package.

First we wish to create a DNA string using generate_dna(). The function generate_dna() takes a integer and generates a random DNA string of the given length.

dna <- generate_dna(length_of_dna = 75)
dna
#> [1] "ATTCGGCTGCCAATTCACACGTCTAGGGTAATTTGGATCTGCAGCCCCTAGTTCTTATCAACCAGTTGCAACCAT"

Next, we wish to translate the DNA to RNA using the function T_to_U(). The function T_to_U() takes as input a DNA sequence and converts it a RNA sequence simply by substituting all T´s with U´s.

rna <- T_to_U(DNA_sequence = dna)
rna
#> [1] "AUUCGGCUGCCAAUUCACACGUCUAGGGUAAUUUGGAUCUGCAGCCCCUAGUUCUUAUCAACCAGUUGCAACCAU"

Once a RNA sequence has been generated, we want to translate the RNA sequence into amino acids, however first we need to create codons from the RNA sequence using format_to_codons(). The function takes a RNA sequence as input and where the first condon starts and returns the RNA condons.

rna_codons <- format_to_codons(rna_seq = rna, start = 1)
rna_codons
#>  [1] "AUU" "CGG" "CUG" "CCA" "AUU" "CAC" "ACG" "UCU" "AGG" "GUA" "AUU" "UGG"
#> [13] "AUC" "UGC" "AGC" "CCC" "UAG" "UUC" "UUA" "UCA" "ACC" "AGU" "UGC" "AAC"
#> [25] "CAU"

Then, these codons can now be translated to amino acids using the translate_codons() function. This function takes the RNA condons as input and returns as amino acids sequence.

amino_acids <- translate_codons(rna_codons)
amino_acids
#> [1] "IRLPIHTSRVIWICSP_FLSTSCNH"

At last we want to visualize the distribution of the amino acids using the plot_aa_dist(). This function takes as input a amino acid sequence and produces a plot of the count distribution of all the amino acids found in the sequence.

plot_aa_dist(amino_acids)

Other use cases

We see fit that the individual functions could be used for bioinformatics work in other pipelines. One might want to extract the amino acid sequence from a DNA or RNA sequence. Another use case to be to the generate_dna() to generate random DNA sequence for testing a computational tool, which works on DNA data. It could be interesting to include a function which calculates the GC-content of the DNA sequence. Further, it would be nice to a the ability to visualize the the different physicochemical properties of the amino acids. This could e.g. be a plot showing the distribution of the different amino acid physicochemical classes.

Main points from discussion

Meaningful names help create quick overview and interpretation of the functions in the package. Having less dependencies means faster load, less overwriting of functions names/conflict in namespace and less mess when other packages needs to be update and might change their functionality.

About

No description, website, or topics provided.

Resources

License

Unknown, MIT licenses found

Licenses found

Unknown
LICENSE
MIT
LICENSE.md

Stars

Watchers

Forks

Releases

No releases published

Packages

 
 
 

Contributors

Languages