Indel discount feature

[bwlang]

fixes issue #114

[bwlang]

This hardcoded discount is a proof of concept... it produces the desired consensus sequence (discount_ivar.fa) but needs more work to figure out how to get an option into the user interface and to confirm that it does not produce unwanted indels elsewhere.

(seq) ➜  data git:(indel_discount) ✗ cut -c 22180-22240 std_ivar.fa

GCACACGCCTATTATAGTGCGTNNNNNNNNNGATCTCCCTCAGGGTTTTTCGGCTTTAGAA
(seq) ➜  data git:(indel_discount) ✗ cut -c 22180-22240 discount_ivar.fa

GCACACGCCTATTATAGTGCGTGAGCCAGAAGATCTCCCTCAGGGTTTTTCGGCTTTAGAA```