A User Guide for Mapping QTL onto the Most Recent Release of the Chromosome-scale Pseudomolecules in Flax
Frank M. You and Sylvie Cloutier
Ottawa Research and Development Centre, Agriculture and Agri-Food Canada, Ottawa, ON K1A 0C6, Canada
This user guide provides a brief description of the methods with their software tools and database files for mapping QTL onto the most recent release of the chromosome-scale pseudomolecules in flax (You et al. 2018).
In the supplementary files, there is a folder named "program_packages" that contains four Perl scripts (Program_S[1-4]_*.pl), a user guide document (UserGuide_S1.pdf), and two subfolders "sample_data" and "database_files". Please copy all scripts and files in the two subfolders to a working folder.
The most recent release of the flax pseudomolecules (You et al. 2016) includes 15 sequences corresponding to 15 flax chromosomes. Their accession numbers in NCBI and sequence lengths are listed in the following table:
Sequences of 15 chromosomes in the NCBI database.
| Chromosome | NCBI accession | Length of sequence (bp) |
|---|---|---|
| Lu1 | CP027619 | 29,425,369 |
| Lu2 | CP027626 | 25,730,386 |
| Lu3 | CP027627 | 26,636,119 |
| Lu4 | CP027628 | 19,927,942 |
| Lu5 | CP027629 | 17,699,757 |
| Lu6 | CP027630 | 18,078,158 |
| Lu7 | CP027631 | 18,299,719 |
| Lu8 | CP027632 | 23,785,339 |
| Lu9 | CP027633 | 22,091,576 |
| Lu10 | CP027620 | 18,203,127 |
| Lu11 | CP027621 | 19,887,771 |
| Lu12 | CP027622 | 20,889,232 |
| Lu13 | CP027623 | 20,483,506 |
| Lu14 | CP027624 | 19,392,306 |
| Lu15 | CP027625 | 15,636,771 |
| Total | 316,167,078 |
These sequences can be downloaded directly from the NCBI nucleotide databases by searching individual accession number, for example, at https://www.ncbi.nlm.nih.gov/nuccore/CP027619, or by using NCBI Batch Entrez for batch download at https://www.ncbi.nlm.nih.gov/sites/batchentrez. All sequences can be saved in a fasta file.
If you only need to convert coordinates of SNPs from the scaffolds based reference sequences onto the most recent release of the chromosome-scale pseudomolecules, you do not need to download these sequence. These sequences are required only when you map PCR based markers to the flax pseudomolecules.
The electronic PCR (e-PCR) method is used to map paired PCR primers onto the flax pseudomolecules (Schuler, 1997). The source code for the e-PCR program is freely available (ftp://ncbi.nlm.nih.gov/pub/schuler/e-PCR/).
Two executive programs, "fahash" and "re-PCR", are included in the e-PCR program package. You need to download the source code to compile it and then place two executable files into the same working directory. The two executable programs can be also saved in any other folder but a path pointing to them must be correctly set so that the Perl scripts can access them.
Step 1. Create a search database
Usage:
perl ProgramS1_prepare_rePCR_data.pl
-i fasta file name of the reference sequence (* is allowed)
-s genome name as file name prefix
-m maximum number of sequences for each database (Default:5000)
Default parameters for the "fahash" program are used in the ProgramS1_prepare_rePCR_data.pl script:
$cmd = "fahash -b $genome_hash -w 12 -f3 $genome_map";
Two output files "*.famap" and "*.hash" will be generated in this step.
Step 2. Mapping PCR markers to the reference genome
Usage:
perl ProgramS2_rePCR_pipeline.pl
-p primer file (required)
-d reference genome hash file (required, generated from
ProgramS1_prepare_rePCR_data.pl, both *.famap and *.hash must be available)
-m number of mismatches (default: 0)
-g number of gaps (default: 0)
Example:
Step 1:
Flax pseudomolecule sequences are saved in a file in fasta format, e.g., flax_pseudomolecules.fasta
perl ProgramS1_prepare_rePCR_data.pl -i flax_pseudomolecules.fasta
-s flax_new_pseudo
Two output files will be generated in this step:
flax_new_pseudo_1.famap
flax_new_pseudo_1.hash
Step 2:
perl ProgramS2_rePCR_pipeline.pl
-p program_S2_sample_marker_data.txt
-d flax_new_pseudo_1.hash
A sample marker file "program_S2_sample_marker_data.txt" is included in the program package. This file contains a header line with four columns separated by a tab key (\t). The last column is the amplicon size range of the PCR marker. It must have the following format:
Primer ID Forward Primer Reverse Primer Size range
Lu2164 GCATGATCGTTACTTTAGGATGC AATGACGCCATCTTTTGTCC 50-1500
Lu2183 CTTCATGCAGTCCGTTTTTACA CAGTTCGTAGTTTACTTGGTGCAG 50-1500
Lu2532 GGATAGAAGCTCACCGATGC TTCAGAGCACCAGCAGAAAA 50-1500
Lu2545 TGCTTTGCTAATTTATTATGGTGAG ATGGTAGCTGGTGGGTGAAC 50-1500
Lu2555 TCCCGCTTTTAATGGTGTTC AATTGGAAGCTCGATTCACG 50-1500
Lu2560 CGTGGCTACTAGCAATGTGG TCCTCATGTTCATTGCTTGC 50-1500
Lu2564 TTTCAGCTTCGATTGAGACG ATCCGTCGAGGTAACAGTCC 50-1500
The "flax_new_pseudo_1.hash" and "flax_new_pseudo_1.famap" generated from Step 1 must be in the same working directory.
An output file "program_S2_sample_marker_data.txt_primer_rePCR_results.txt" will be generated:
#-sts seq strand from to mism gaps act_len/exp_len
Lu2164 1 - 22948222 22948580 0 0 359/50-1500
Lu2183 1 - 26435050 26435329 0 0 280/50-1500
Lu2555 6 + 14948801 14948986 0 0 186/50-1500
Lu2560 6 - 13553559 13553779 0 0 221/50-1500
Lu2564 6 - 13620999 13621234 0 0 236/50-1500
Lu2532 7 - 661757 662020 0 0 264/50-1500
#-
Done
3. Mapping SNPs on scaffold reference sequences to the most recent release of the chromosome-scale pseudomolecules
Usage:
perl ProgramS3_convert_scaffold_coordinates_to_pseudochr.pl
-m scaffold to pseudomolecule mapping file. Table S4 must be used.
-d scaffold coordinate data file which must have three column: marker
name, scaffold IDs and coordinates
The "program_S3_sample_marker_data.txt" is a sample marker data file that must contain three columns separated by a tab key (\t):
Marker Scaffold ID Coordinate_on_scaffold
scaffold112_114241 scaffold112 114241
scaffold1491_318496 scaffold1491 318496
scaffold31_1800846 scaffold31 1800846
scaffold344_309662 scaffold344 309662
scaffold51_1349321 scaffold51 1349321
scaffold59_572553 scaffold59 572553
scaffold156_641874 scaffold156 641874
scaffold147_367986 scaffold147 367986
scaffold859_123972 scaffold859 123972
scaffold297_275113 scaffold297 275113
scaffold361_14957 scaffold361 14957
scaffold273_68457 scaffold273 68457
The "TableS4_flax_scaffolds_corrdinates_in_new_pseudomolecules.txt" is a database file that contains accurate information for mapping scaffold sequences to the pseudomolecules. This file is provided in the program package.
Example:
perl ProgramS3_convert_scaffold_coordinates_to_pseudochr.pl
-m TableS4_flax_scaffolds_corrdinates_in_new_pseudomolecules.txt
-d program_S3_sample_marker_data.txt
A "program_S3_sample_marker_data.txt.converted.txt" will be generated:
Marker Scaffold ID Coordinate_on_scaffold Chr New_Chr_Coord
scaffold112_114241 scaffold112 114241 1 18444086
scaffold1491_318496 scaffold1491 318496 6 14006651
scaffold31_1800846 scaffold31 1800846 3 3929932
scaffold344_309662 scaffold344 309662 1 11008279
scaffold51_1349321 scaffold51 1349321 4 10532424
scaffold59_572553 scaffold59 572553 1 10051709
scaffold156_641874 scaffold156 641874 3 5906791
scaffold147_367986 scaffold147 367986 5 11288517
scaffold859_123972 scaffold859 123972 15 1939372
scaffold297_275113 scaffold297 275113 1 16435852
scaffold361_14957 scaffold361 14957 1 16726904
scaffold273_68457 scaffold273 68457 8 585113
The last two columns are the converted results, including chromosome numbers and new coordinates on chromosomes.
Usage:
perl ProgramS4_flax_QTL_candidate_gene_scanning.pl
-q QTL file
-d gene annotation file
-w upstream or downstream window size (bp) (default: 100000 bp)
A sample data file for QTL data "program_S4_sample_qtl_data.txt" is provided in the program package. This file must have four columns separated by a tab key (\t):
Trait QTL Chr Coord_start Coord_end
PM QPM-crc-LG1 1 16920407 18739647
PM QPM-crc-LG7 7 3817603 3817863
PM QPM-crc-LG9 9 357191 357510
The gene annotation files "TableS6_flax_RGA_coords.txt" and "TableS5_flax_all_genes_coords.txt" are two database files that contain coordinates of all resistance gene analogs (RGAs) or all protein coding genes on the pseudomolecules and their functional annotation information. Each of them can be used for a different purpose (scanning RGAs or all genes). These two files are provided in the program package.
The upstream or downstream window size of the QTL position can be specified. The default value is 100000 bp (i.e. 100 kb). That means that all genes/RGAs within a total of 200 kb window of both upstream and downstream of a QTL on a chromosome will be scanned. You can input a different value for the window size.
Example 1: scan resistance gene analogs within a 200 kb window covering upstream and downstream of the QTL position (default)
perl ProgramS4_flax_QTL_candidate_gene_scanning.pl
-q program_S4_sample_qtl_data.txt
-d TableS6_flax_RGA_coords.txt
A result file "program_S4_sample_qtl_data.txt_gene_annotations.txt" will be generated in the following format:
Example 2: scan all protein coding genes within a 200 kb window covering upstream and downstream of the QTL position (default)
perl ProgramS4_flax_QTL_candidate_gene_scanning.pl
-q program_S4_sample_qtl_data.txt
-d TableS5_flax_all_genes_coords.txt
A result file with the same file name "program_S4_sample_qtl_data.txt_gene_annotations.txt" will be generated in the following format that slightly different from Example 1 (only part of results are shown):
References
You, F.M.; Xiao, J.; Li, P.; Yao, Z.; Jia, G.; He, L.; Zhu, T.; Luo, M.-C.; Wang, X.; Deyholos, M.K., et al. Chromosome-scale pseudomolecules refined by optical, physical, and genetic maps in flax. Plant J. 2018, 95, (2), 371-384.
Schuler, G.D. Sequence mapping by electronic PCR. Genome Res. 1997, 7, (5), 541-550.