It is unclear from the documentation if I can use ultraplex to demultiplex dual-indexed, single-end fastq.gz files with index in header of the sequence (from an Illumina run).
And example of a file is below:
@NS500234:1288:HV3H7BGXK:1:11101:17660:1049 1:N:0:TAGCTTAT+AGATCTCG
CTGAGTAATTNATAAACAGTAGAAGTTTGCTTGGCTCATGGTTCTGGAGACTGGGAAGTCCAAGATTGAGGGACT
+
AAAAAEEEEE#EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE
@NS500234:1288:HV3H7BGXK:1:11101:8789:1049 1:N:0:GTCCTTGA+TCAGCCGA
GGCCCACCGGNGCTGTGCTGGATTTCTCGCTGGGCCTTAGCTGCCTTCCCGCGGGGCAGGGCTCGGGACCTGC
+
AAAAAEEEEE#EEEEEEEEEE/EEEEAEEEEEEEEEEEEEEEEEEEEEEEE6EAEEEEEEEEA<EEEEEEEEE
For each combination of i7, i5 indexes, there is a unique filename, as bellow
TAGCTTAT+AGATCTCG, Sample1
GTCCTTGA+TCAGCCGA, Sample2
If it is possible, what would be the format of the index file to be able to demultiplex those files? Can anyone give me an usage example to successfully demultiplex this? Thanks.
It is unclear from the documentation if I can use
ultraplexto demultiplex dual-indexed, single-end fastq.gz files with index in header of the sequence (from an Illumina run).And example of a file is below:
For each combination of i7, i5 indexes, there is a unique filename, as bellow
If it is possible, what would be the format of the index file to be able to demultiplex those files? Can anyone give me an usage example to successfully demultiplex this? Thanks.