Skip to content

Latest commit

 

History

History
160 lines (117 loc) · 5.11 KB

File metadata and controls

160 lines (117 loc) · 5.11 KB

MapComp

A Genetic Map Comparison Pipeline

Introduction

MapComp facilitates the visual comparison among linkage maps of similar taxons in order to assess their quality and to simplify the exploration of their genomic evolution. The novelty of the approach lies in the use of a reference genome in order to maximize the number of marker pairs that can be compared among maps, even when completely different library preparation protocols have been used to create the map markers. As such, it requires the existence of an assembled genome for a species that is phylogenetically close to the species with the maps that are being compared.

Using MapComp

The main steps in using MapComp are:

  • Get a reference genome and put here: 02_data/genome/genome.fasta
  • Index the reference genome (bwa index 02_data/genome/genome.fasta)
  • Get marker data from two or more taxa
  • Prepare .csv marker file (see 02_data/tutorial_markers.csv for exact format)
  • Prepare fasta marker file automatically from .csv file
  • Run mapcomp, which will:
    • Map marker sequences on genome scaffolds
    • Filter out non-unique and bad quality alignments
    • Keep only the best marker pairs
    • Create figures

Dependencies

In order to use MapComp, you will need the following:

  • Linux or MacOS
  • Python 2.7
  • numpy (Python library)
  • bwa
  • samtools
  • The R statistical language

If you are using a Debian derived Linux distribution, for example Ubuntu or Linux Mint, you can install all the required tools with the following command:

sudo apt-get install bwa samtools r-base-core

Tutorial

A tutorial data set of markers for two species and a reference genome are included in MapComp. Both the genome and marker data used for the tutorial were created in silico. As a result, the figures will look too perfect. However, the goal of the tutorial to run a full MapComp analysis once as an example of how to use it with your real data. Additionally, the tutorial .csv data file serves as an example of the exact format required for the marker .csv file, which contains the marker information for the analyzed species.

Once you have produced the figures from the tutorial data, then using MapComp on your data will be as easy as preparing the .csv file, automatically creating the markers fasta file, getting and indexing the reference genome and running ./mapcomp.

Tutorial run

# Rename and index genome
cp 02_data/genome/tutorial_genome.fasta 02_data/genome/genome.fasta
bwa index 02_data/genome/genome.fasta

# Prepare fasta file
./01_scripts/00_prepare_input_fasta_file_from_csv.sh 02_data/tutorial_markers.csv

# Run mapcomp
./mapcomp

You can now look at the figures in the 04_figures folder and at the linkage group correspondance among the species in the 05_results folder.

Data preparation

In order to compare linkage maps, you will need to collect the following information about each marker:

  • Species name (eg: hsapiens)
  • Linkage Group number (eg: 1, 2, 3...)
  • Position in centi Morgans, or cM (eg: 0, 5.32, 22.8)
  • Marker Identifier (eg: marker0001)
  • Marker Nucleotide Sequence (60 base pairs of more)

Once you have all this information about the markers, you will need to create a .csv file containing these informations. The .csv file will feature one extra column containing zeroes and be in the following format:

SpeciesName,LG,Position,Zeroes,markerName,markerSequence

Here is what the .csv file may look like:

hsapiens,1,0.58,0,marker0001,CGGCACCTCCACTGCGGCACGAAGAGTTAGGCCCCGTGCTTTGCGG
hsapiens,1,5.74,0,marker0002,CGGCACCTCCACTGCGGCACGAAGAGTTAGGCCCCGTGCTTTGCGG
...
hsapiens,1,122.39,0,marker0227,CGGCACCTCCACTGCGGCACGAAGAGTTAGGCCCCGTGCTTTGCGG

Use the 02_data/tutorial_markers.csv file as a template for your own .csv file.

Note that:

  • There is no header line in the .csv file
  • There are 6 columns of information
  • The different columns are separated by a comma (,)
  • The fourth column is filled with zeroes (0)
  • You need more than one map in the .csv file
  • You should avoid special characters, including underscores (_) in the marker names
  • You must use the period (.) as the decimal separator (no comma (,))

Automatically creating the markers fasta file

The .csv file will be used to create a fasta file using the following script:

./01_scripts/00_prepare_input_fasta_file_from_csv.sh <your_file.csv>

This will produce a file named 02_data/marker.fasta.

Preparing the reference genome

Once you have a reference genome in fasta format, copy it here: 02_data/genome/genome.fasta and index it with bwa:

bwa index 02_data/genome/genome.fasta

Running MapComp

Once your data has been prepared and your reference genome is indexed, running mapcomp is as easy launching the following command:

./mapcomp

Citing

If you use MapComp in your research, please cite:

Sutherland BJG, Gosselin T, Normandeau E, Lamothe M, Isabel N, Bernatchez L. Novel method for comparing RADseq linkage maps reveals chromosome evolution in salmonids. bioRxiv. 2016: 1–44. doi:10.1101/039164

License

MapComp is licensed under the GNU General Public Licence version 3 (GPL3). See the LICENCE file for more details.