Core dump on simple example

[blinard-BIOINFO]

Hi,
I'm trying to use tagdust on the simplest toy example I can imagine, but always get a core dump result.
Can you tell me what I'm doing wrong ?

Thank you.

Command:
./tagdust -1 B:AACGCTTC -2 R:N sample.fasta -o test

Input sequences (sample.fasta):

>M00234:812:000000000-J36YP:1:1102:17688:2041 1:N:0:GAGTGG
AAAACGCTTCCTTCCGGTACACTTACCATGTTACGACTTGTCTCCTCTATATAAATGCGTAGGGGTTTTAGTTAAATGTCCTTTGAAGTATACTTGAGGAGAGTGACGGGCGGTGTGAAGCGTTG

As you can see, the barcode is present at the 3rd position of the input sequence.
But I got this error:

$ ./tagdust -1 B:AACGCTTC -2 R:N  sample.fasta -o test 
[2020-05-22 12:08:27]	Tagdust 2.32, Copyright (C) 2013-2019 Timo Lassmann <timolassmann@gmail.com>
[2020-05-22 12:08:27]	cmd: ./tagdust -1 B:AACGCTTC -2 R:N -o test /home/ben/Dropbox/SPYGEN/DEMUX_TESTS/vsearc_merged_sample.fasta 
[2020-05-22 12:08:27]	Start Run
--------------------------------------------------
[2020-05-22 12:08:27]	Determining threshold for read0.
[2020-05-22 12:08:39]	Long sequence found. Need to realloc model...
[2020-05-22 12:09:13]	Selected Threshold:: 0.513514
Segmentation fault (core dumped)