some variant can't output in two reapeat sample

[litun-fkby]

Hi，
recently,i ues the vardict1.8.3 to call the snv/indel , the data is PCR Amplicon , and i use the Amplicon Mode,the command is :
vardict_parameter=" -c 1 -S 2 -E 3 -g 4 -I 50 -r 5 -f 0.01 -U -m 15 -p -a 10:0.95"
vardict_parameter2="-f 0.01 -r 5 -P 0 -m 15"
VarDict -th 8 -G ref.genome.fasta -N sample_name -b bam $vardict_parameter bed > sample_name.raw.variants
cat sample_name.raw.variants | Rscript teststrandbias.R --no-save > sample_name.raw.variants.strand_bias
var2vcf_valid.pl -E -A -N sample_name $vardict_parameter2 sample_name.raw.variants.strand_bias > sample_name.raw.vcf
the two data is the reapeat data form one sample,and i find some variant don't output in both two result, such as :

the record:
NC_029265.1 21330681 . G A 413 PASS SAMPLE=s1_01a;TYPE=SNV;DP=16278;VD=6428;AF=0.3949;BIAS=2:2;REFBIAS=4913:4920;VARBIAS=3218:3210;PMEAN=38;PSTD=1;QUAL=32.7;QSTD=1;SBF=0.91061;ODDRATIO=1.00392534811111;MQ=60;SN=193.788;HIAF=0.3953;ADJAF=0.1945;SHIFT3=0;MSI=1;MSILEN=1;NM=4.1;HICNT=6395;HICOV=16177;LSEQ=GTTTCAATTGATTCATTTCA;RSEQ=TCTTTGTTCCAATTGATTCA;GDAMP=1;TLAMP=1;NCAMP=0;AMPFLAG=0 GT:DP:VD:AD:AF:RD:ALD 0/1:16278:6428:9833,6428:0.3949:4913,4920:3218,321

and i use the igv to find that this variant have the reads support but not in s1_01b output:

is my command wrong? or other option to add ?
thanks!